Cloning DNA restriction endonuclease fragments with protruding single-stranded ends.
نویسندگان
چکیده
A new method of in vitro recombination was employed to construct plasmids containing lac promoter fragments 64 bp and 144 bp long. The 64 bp HpaII-HhaI fragment contains the binding site for the catabolite activator protein (CAP). The HpaII-HaeIII 144 bp fragment includes the binding sites for RNA polymerase, the lac repressor and CAP. The method utilizes the ability of T4 DNA polymerase to make flush-ended DNA either by filling in a recessed 3'-end or by exonucleolytic removal of a protruding 3'-end. The treated fragments were then blunt-end ligated to the filled-in EcoRI cloning sites of the plasmids pVH51 and pBR322 using T4 ligase. In this process, the EcoRI sites were regenerated on the fragment ends thus facilitating the subsequent isolation of the fragments from their cloning vectors.
منابع مشابه
Directional cloning of DNA fragments using deoxyinosine-containing oligonucleotides and endonuclease V
BACKGROUND DNA fragments carrying internal recognition sites for the restriction endonucleases intended for cloning into a target plasmid pose a challenge for conventional cloning. RESULTS A method for directional insertion of DNA fragments into plasmid vectors has been developed. The target sequence is amplified from a template DNA sample by PCR using two oligonucleotides each containing a s...
متن کاملLigation-mediated PCR amplification of specific fragments from a class-II restriction endonuclease total digest.
A method is described which permits the ligation- mediated PCR amplification of specific fragments from a Class-II restriction endonuclease total digest. Feasibility was tested using Bcl I and phage lambda DNA as a model enzyme and amplicon system, respectively. Bcl I is one of many widely used restriction enzymes which cleave at palindromic recognition sequences and leave 5'-protruding ends of...
متن کاملIsolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions.
MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleo...
متن کاملCloning of random-sequence oligodeoxynucleotides.
Methods are described for cloning random or highly degenerate nucleotide (nt) sequences. The procedures use synthetically derived mixtures of oligodeoxynucleotides (oligos) whose heterogeneous central portions are bounded at their 5' and 3' ends by sequences recognized by restriction endonucleases. Oligo collections of defined length and nt composition are synthesized by utilizing appropriate c...
متن کاملUse of oligonucleotides and nick translation for site-directed mutagenesis in plasmids.
Several methods of oligonucleotide-directed mutagenesis in plasmids are currently available (1—4). Unfortunately, low frequencies of target mutations are commonly observed. In this communication we present a new, effective and rather general approach for oligonucleotide-directed site-specific mutagenesis and cloning of single-stranded DNA fragments in double-stranded circular vectors without us...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Gene
دوره 9 3-4 شماره
صفحات -
تاریخ انتشار 1980